ParmBSC1 forcefield Nucleotide MD Simulations Database

Found 301 records matching search conditions

First shown

Click on Id to open Simulation Metadata and Analyses

  Id. Type Subtype Time (ns) Sequence
NAFlex_1d11 Dna duplex 1,000 CGTACG
NAFlex_1d89 Dna duplex 200 CGCGAAAAAACG
NAFlex_1fzx Dna duplex 200 GGCAAAAAACGG
NAFlex_1g14 Dna duplex 1,000 GGCAAGAAACGG
NAFlex_1hlv Dna duplex 1,000 AATCCCGTTTCCAACGAAGGC
NAFlex_1iv6 Dna duplex 1,000 CCCTAACCCTAAC
NAFlex_1j5n Dna duplex 1,000 CTGAACAATCACCCC
NAFlex_1pqt Dna single hairpin 1,000 GCGAAGC
NAFlex_1rvh Dna duplex 200 GCAAAATTTTGC